PrecisionFDA
Hidden Treasures - Warm Up


Find variants injected into an NGS dataset


  • Starts
    2017-07-18 00:00:00 UTC
  • Ends
    2017-09-13 06:59:00 UTC

The precisionFDA Hidden Treasures – Warm Up ran from July 19, 2017 to September 13, 2017. It provided participants a unique opportunity to investigate the accuracy of their pipelines by testing the ability to find in silico injected variants in FASTQ files from exome sequencing of reference cell lines. It was offered as a warm up ahead of potentially more difficult in silico challenge(s) to come. There were 86 valid entries from 30 participants to the challenge.
This precisionFDA Hidden Treasures – Warm Up challenge results page displays the summarized results as two separate tables, with the opportunity to click on some of the features in each table and get more detailed information. As with previous challenges, due to novelties related to the truth data and the comparison methodology, these results offer a first glance at our understanding. We welcome the community to further explore these results and provide insight for the future.

Introductory Remarks

At the start of this challenge, users were provided with a NA12878 whole exome sequencing FASTQ file that had been in silico modified with single nucleotide variants (SNVs) and insertion and deletion (InDel) variants (less than 40 bp) at approximate Variant Allele Frequencies (VAFs) ≥20%. This precisionFDA note summarizes certain precisionFDA artifacts related to the challenge, including a VCF with the injected variants, as well as the VCF evaluation app which was used by the system to automatically evaluate all entries. We invite the community to try the evaluation app and give us any feedback.


Overview of Results

Challenge participants ran the modified FASTQ file through their pipeline(s), and returned the resulting VCF file to precisionFDA for comparison to the known reference truth using a VCF evaluation app that we created. The first table below shows calls for 50 injected variants, including SNVs and InDels sorted separately by size (1-3 bp, 4-6 bp, 7-9 bp, 10-12 bp, and larger than 13 bp), for each entry in a separate row. Results shown for each entry also include whole exome recall, precision and F-score* for overall SNVs and overall InDels:

  • Recall, or sensitivity, reflects the percentage of variants in the NIST/GiaB benchmark set that were exactly called by the challenge participant pipeline in a submitted dataset.
  • Precision, or positive predictive value, reflects the percentage of called variants which match exactly the NIST/GiaB benchmark set.
  • F-score is the harmonic mean of recall and precision, and is sometimes used as a single combined metric for evaluating overall accuracy.
The entries are sorted alphabetically by the name of the submitter, since many submitters had multiple entries. Moreover, the Entry column contains a link to the precisionFDA job that resulted from the execution of the evaluation app on that entry. All jobs, and the resulting files as output by the evaluation app, have been made public on precisionFDA and are owned by the special user 'Challenge Robot'.

Participants whose submissions correctly detected and called all 50 injected variants (regardless of the whole exome precision, recall and F-score for their pipeline/submission) are being recognized as Warm Up in silico Variant Catchers and are designated with the Variant Catcher icon in the table (45 entries earned that title).

* The terminology currently used in this discussion (such as "precision" and "recall") is not necessarily harmonized with definitions used by ISO, CLSI, or FDA, but are terms commonly used by NGS software developers.


Injected indels Injected Whole-exome SNP Whole-exome indel
Submitter Organization Entry 1-3 4-6 7-9 10-12 13+ SNPS Total precision recall F-score precision recall F-score
Vijay Walia Variant Catcher FDA VW_submission_1 11 11 11 11 1 5 50 0.990646 0.99029 0.990468 0.716542 0.858191 0.780996
Justin Lack Variant Catcher NIH JLack_CCBR_Leidos_StandardPipeline_relaxed 11 11 11 11 1 5 50 0.993357 0.988074 0.990708 0.788118 0.858511 0.82181
Justin Lack Variant Catcher NIH JLack_CCBR_Leidos_StandardPipeline_noFilter 11 11 11 11 1 5 50 0.990352 0.988212 0.989281 0.710399 0.860213 0.778161
Chung Tsai Su Atgenomix SeqsLab with GATK-based Parallelization 11 11 11 11 0 5 49 0.994188 0.976203 0.985113 0.695819 0.849043 0.764832
Chung Tsai Su Atgenomix SeqsLab with GATK-based Parallelization(conf>30) 11 11 11 11 0 5 49 0.995428 0.974222 0.984711 0.746753 0.843404 0.792141
Igor Dolgalev Variant Catcher NYU Langone Medical Center GATK HaplotypeCaller unfiltered 11 11 11 11 1 5 50 0.985822 0.982145 0.98398 0.751669 0.854043 0.799592
Igor Dolgalev Variant Catcher NYU Langone Medical Center GATK HaplotypeCaller depth-filtered 11 11 11 11 1 5 50 0.986218 0.903786 0.943204 0.743792 0.792979 0.767598
Theresa Wohlever Variant Catcher Test 11 11 11 11 1 5 50 0.991177 0.991343 0.99126 0.661186 0.867447 0.750401
Rafael Aldana Variant Catcher Sentieon Inc Sentieon_DNAseq_std-NA12878MOD 11 11 11 11 1 5 50 0.995136 0.989085 0.992101 0.748639 0.86266 0.801615
Rafael Aldana Variant Catcher Sentieon Inc Sentieon_TNscope_Tonly_std-NA12878MOD 11 11 11 11 1 5 50 0.600924 0.598465 0.599692 0.394585 0.413936 0.404029
Jongsuk Chung Samsung Genome Institute SGI_1st_result 4 6 6 4 0 4 24 0.990799 0.989002 0.9899 0.752093 0.859362 0.802157
Jongsuk Chung Samsung Genome Institute SGI_2nd_filtration 5 9 7 7 0 5 33 0.9893 0.991357 0.990327 0.697161 0.866489 0.772657
Jongsuk Chung Samsung Genome Institute SGI_4th_filtration 7 11 8 10 1 5 42 0.587313 0.601263 0.594206 0.432052 0.43734 0.43468
Jongsuk Chung Samsung Genome Institute SGI_3rd_filtration_rere 7 10 6 8 0 5 36 0.964913 0.991744 0.978145 0.612791 0.843085 0.709724
Mark Cowley Variant Catcher Garvan Institute KCCG_1.7.0_HC 11 11 11 11 1 5 50 0.995136 0.989085 0.992101 0.727712 0.865 0.790439
Mark Cowley Garvan Institute KCCG_1.7.0_VD 11 10 9 11 1 5 47 0.996376 0.96972 0.982867 0.805216 0.745665 0.774297
Rongshan Yu Variant Catcher Aginome Scientific NA12878MOD.imp.vcf.gz 11 11 11 11 1 5 50 0.992302 0.990955 0.991628 0.701692 0.859681 0.772693
Rafael Aldana Variant Catcher Sentieon Inc Sentieon_DNAseq_nodecoy-NA12878MOD 11 11 11 11 1 5 50 0.991941 0.988905 0.99042 0.751527 0.862872 0.80336
Rafael Aldana Variant Catcher Sentieon Inc Sentieon_TNscope_Tonly_nodecoy-NA12878MOD 11 11 11 11 1 5 50 0.598495 0.598202 0.598348 0.39834 0.41734 0.407619
Severine Catreux Variant Catcher Edico Genome DRAGEN_DNASeq_NA12878MOD_submission1 11 11 11 11 1 5 50 0.991705 0.991966 0.991835 0.834423 0.895638 0.863947
Severine Catreux Variant Catcher Edico Genome DRAGEN_DNASeq_NA12878MOD_submission2 11 11 11 11 1 5 50 0.972662 0.992271 0.982369 0.705784 0.89917 0.790826
Severine Catreux Edico Genome DRAGEN_DNASeq_NA12878MOD_submission3 10 11 11 11 1 5 49 0.996531 0.990886 0.9937 0.933809 0.820213 0.873333
Severine Catreux Edico Genome DRAGEN_DNASeq_NA12878MOD_submission4 10 11 11 11 1 5 49 0.998621 0.962947 0.98046 0.957514 0.771277 0.854364
Severine Catreux Variant Catcher Edico Genome DRAGEN_DNASeq_NA12878MOD_submission5 11 11 11 11 1 5 50 0.996848 0.990165 0.993496 0.888806 0.883617 0.886204
Rongshan Yu Variant Catcher Aginome Scientific NA12878MOD.imp.v2.recode.vcf.gz 11 11 11 11 1 5 50 0.991168 0.991814 0.991491 0.68785 0.861596 0.764981
Rongshan Yu Variant Catcher Aginome Scientific NA12878MOD.imp.v3.recode.vcf 11 11 11 11 1 5 50 0.990116 0.992146 0.99113 0.670604 0.862872 0.754685
Sunho Lee Syntekabio ADIscan_NA12878MOD_all 11 11 11 10 0 5 48 0.987261 0.989348 0.988303 0.672161 0.82174 0.739462
Sunho Lee Syntekabio ADIscan_NA12878MOD_filtered 11 11 11 10 0 5 48 0.989856 0.989029 0.989442 0.688306 0.819506 0.748198
Sunho Lee Syntekabio ADIscan_NA12878MOD_tight 11 11 11 10 0 5 48 0.991681 0.988655 0.990166 0.69806 0.817167 0.752932
Sunho Lee Syntekabio ADIscan_NA12878MOD_conf 11 11 11 10 0 5 48 0.99274 0.988309 0.99052 0.70274 0.815146 0.754781
Hua Chen Variant Catcher Beijing Institute of Genomics 11 11 11 11 1 5 50 0.988619 0.988642 0.98863 0.669671 0.823974 0.738852
Hua Chen Variant Catcher BIG_NGSToolkit-NA12878.vcf 11 11 11 11 1 5 50 0.991675 0.98842 0.990045 0.826387 0.699574 0.757712
Hua Chen Variant Catcher BIG_CelerSNP-NA12878MOD.vcf 11 11 11 11 1 5 50 0.988619 0.988642 0.98863 0.669671 0.823974 0.738852
Hua Chen Variant Catcher BIG_CelerSNP-NA12878.vcf 11 11 11 11 1 5 50 0.988619 0.988642 0.98863 0.669671 0.823974 0.738852
Liu Xueying Challenge_submission_20170912_3 11 11 11 11 0 5 49 0.993592 0.249152 0.398401 0.873303 0.041064 0.078439
Angela Pozo INGEMM HULP-germ 11 11 11 10 0 5 48 0.984124 0.325406 0.489091 0.651468 0.132128 0.219697
Sam Friedman Broad Institute Experimental Unfiltered 11 11 10 11 1 5 49 0.993729 0.990027 0.991874 0.68276 0.839911 0.753226
Colin Hercus Novocraft Technologies NovoalignFreebayes_1 11 10 10 10 1 5 47 0.980632 0.992949 0.986753 0.784889 0.86263 0.821925
Colin Hercus Novocraft Technologies NovoalignFreebayes_2 11 10 8 8 1 5 43 0.992934 0.992188 0.992561 0.836097 0.839115 0.837603
Colin Hercus Variant Catcher Novocraft Technologies NovoalignGATKHC_1 11 11 11 11 1 5 50 0.98731 0.990512 0.988908 0.704128 0.862872 0.775459
Shawn Williams test2 6 11 11 11 1 5 45 0.264135 0.008671 0.016791 0.192833 0.012021 0.022632
Colin Hercus Variant Catcher Novocraft Technologies NovoalignGATKHC_2 11 11 11 11 1 5 50 0.98761 0.990484 0.989045 0.705217 0.861809 0.775689
Angela Pozo INGEMM HULP-mosaic 10 9 6 7 0 3 35 0.94938 0.327677 0.487199 0.765668 0.117447 0.203655
Tian Xia Submission1 11 11 11 10 1 5 49 0.994498 0.986481 0.990473 0.747691 0.860532 0.800153
Steve Laurie Variant Catcher CNAG B8GATK36 11 11 11 11 1 5 50 0.995892 0.973848 0.984746 0.730212 0.835426 0.779283
Steve Laurie Variant Catcher CNAG B15GATK36 11 11 11 11 1 5 50 0.99592 0.973862 0.984767 0.731095 0.835426 0.779786
Steve Laurie Variant Catcher CNAG G3GATK36 11 11 11 11 1 5 50 0.997145 0.972587 0.984713 0.735245 0.834149 0.78158
Shawn Williams test 6 11 11 11 1 5 45 0.264135 0.008671 0.016791 0.192833 0.012021 0.022632
Shawn Williams test 6 11 11 11 1 5 45 0.264135 0.008671 0.016791 0.192833 0.012021 0.022632
Charles Chapple Variant Catcher Saphetor Saphetor1 11 11 11 11 1 5 50 0.994249 0.960121 0.976887 0.78657 0.830106 0.807752
Charles Chapple Variant Catcher Saphetor Saphetor2 11 11 11 11 1 5 50 0.993583 0.971341 0.982336 0.818341 0.821596 0.819965
Charles Chapple Variant Catcher Saphetor Saphetor4 11 11 11 11 1 5 50 0.9955 0.971133 0.983165 0.812949 0.820745 0.816828
Charles Chapple Variant Catcher Saphetor dummy 11 11 11 11 1 5 50 0.993583 0.971341 0.982336 0.818341 0.821596 0.819965
Shawn Williams Variant Catcher submission 11 11 11 11 1 5 50 0.978296 0.986536 0.982399 0.694895 0.860851 0.769021
Zitong He Variant Catcher MySubmission1 11 11 11 11 1 5 50 0.978296 0.986536 0.982399 0.694895 0.860851 0.769021
Charles Chapple Variant Catcher Saphetor dummy 11 11 11 11 1 5 50 0.980753 0.983655 0.982202 0.691801 0.848936 0.762355
Charles Chapple Variant Catcher Saphetor Saphetor3 11 11 11 11 1 5 50 0.993583 0.971313 0.982322 0.818492 0.821489 0.819988
Zitong He MySubmission2 11 11 11 10 1 5 49 0.994512 0.986508 0.990494 0.750626 0.860957 0.802015
Shawn Williams mySubmission_GATK 7 11 10 11 1 5 45 0.363682 0.009959 0.019388 0.125683 0.014681 0.026291
Theresa Wohlever Whole-exome variant calling pipeline results 7 6 5 5 0 5 28 0.989802 0.981577 0.985672 0.768957 0.870134 0.816423
Patrick Brennan Variant Catcher Nationwide Children's Hospital NCH_SUBMISSION1 11 11 11 11 1 5 50 0.99465 0.98896 0.991797 0.674428 0.846383 0.750684
Patrick Brennan Nationwide Children's Hospital NCH_SUBMISSION2 9 10 6 6 1 5 37 0.99873 0.904229 0.949133 0.799462 0.757979 0.778168
Christian Iseli Swiss Institute of Bioinformatics SIB 9 10 8 9 1 5 42 0.985602 0.97443 0.979984 0.753181 0.750585 0.751881
Richa Agarwala NCBI SKESA_SRPRISM 8 8 5 6 0 1 28 0.32541 0.30702 0.315947 0.424784 0.416383 0.420542
Hong Chen Variant Catcher Sentieon Inc Sentieon_DNAseq_allmap-NA12878MOD 11 11 11 11 1 5 50 0.990597 0.989473 0.990035 0.743829 0.864787 0.79976
Hong Chen Variant Catcher Sentieon Inc Sentieon_DNAseq_allmap_nodedup-NA12878MOD 11 11 11 11 1 5 50 0.986758 0.989985 0.988369 0.721072 0.86617 0.786989
Pi Chuan Chang Google DeepVariant 8 10 9 9 1 5 42 0.997713 0.99126 0.994476 0.841122 0.876064 0.858238
Pi Chuan Chang Google DeepVariant_LowFrequency 9 10 9 11 1 5 45 0.997256 0.9918 0.99452 0.813021 0.881277 0.845774
Hanying Feng Variant Catcher Sentieon Inc Sentieon_TNscope_Tonly_allmap-NA12878MOD 11 11 11 11 1 5 50 0.594368 0.602787 0.598548 0.261532 0.539566 0.352301
Hanying Feng Variant Catcher Sentieon Inc Sentieon_TNscope_Tonly_allmap_nodedup-NA12878MOD 11 11 11 11 1 5 50 0.539536 0.603383 0.569676 0.227044 0.538502 0.319416
Hanying Feng Variant Catcher Sentieon Inc Sentieon_Exp-NA12878MOD 11 11 11 11 1 5 50 0.920606 0.99004 0.954061 0.348901 0.857964 0.496069
Hanying Feng Variant Catcher Sentieon Inc Sentieon_Exp_nodedup-NA12878MOD 11 11 11 11 1 5 50 0.822392 0.989846 0.898382 0.331927 0.854878 0.478187
Rongshan Yu Variant Catcher Aginome Scientific NA12878MOD.imp.hardfilter.recode.vcf.gz 11 11 11 11 1 5 50 0.995427 0.985927 0.990654 0.792018 0.858617 0.823974
Liu Qi Variant Catcher BIG_myPipeline-NA12878.vcf.gz 11 11 11 11 1 5 50 0.599349 0.602261 0.600801 0.461185 0.608723 0.524782
Igor Dolgalev NYU Langone Medical Center Bowtie2 + GATK HaplotypeCaller unfiltered 11 11 11 10 1 5 49 0.995208 0.954788 0.974579 0.78762 0.826277 0.806485
Liu Qi BIG_HXG-NA12878.vcf.gz 11 11 10 10 0 5 47 0.989178 0.985802 0.987487 0.471407 0.745905 0.577707
Igor Dolgalev NYU Langone Medical Center Bowtie2 + GATK HaplotypeCaller depth-filtered 11 11 11 10 1 5 49 0.995289 0.892413 0.941048 0.785136 0.776702 0.780896
Sijung Yun Yotta Biomed, LLC. Yotta1_GRCh37_liftover_from_GRCh38_sorted 10 11 11 10 1 5 48 0.992543 0.962503 0.977293 0.738275 0.830106 0.781502
Sijung Yun Yotta Biomed, LLC. Yotta2_GRCh37_liftover_from_GRCh38_sorted 0 0 0 0 0 5 5 0.930078 0.960896 0.945236 0.041667 0.001808 0.003465
Sijung Yun Yotta Biomed, LLC. Yotta3_GRCh37_liftover_from_GRCh38_sorted 10 11 11 10 1 5 48 0.975282 0.965274 0.970252 0.606772 0.835638 0.703048
Igor Dolgalev NYU Langone Medical Center BWA-MEM + GATK + SNVer 11 9 5 8 0 5 38 0.983388 0.93052 0.956224 0.394808 0.467021 0.427889
Severine Catreux Variant Catcher Edico Genome DRAGEN_DNASeq_NA12878MOD_submission6 11 11 11 11 1 5 50 0.972624 0.992326 0.982376 0.705784 0.89917 0.790826
Severine Catreux Variant Catcher Edico Genome DRAGEN_DNASeq_NA12878MOD_submission7b 11 11 11 11 1 5 50 0.993589 0.991551 0.992569 0.8195 0.896299 0.856181
Jean Thierrymieg NCBI NCBI_Magic_ThierryMieg_NA12878MOD.b.vcf.gz 6 4 2 5 0 4 21 0.99067 0.957212 0.973654 0.733128 0.641277 0.684133
Joon Sang Lee Variant Catcher Sanofi JSLee_NA12878MOD_final_2.vcf.gz 11 11 11 11 1 5 50 0.984611 0.959802 0.972048 0.753181 0.825319 0.787602
Joon Sang Lee Sanofi JSLee_NA12878MOD_final_3.vcf.gz 10 10 8 9 1 5 43 0.99641 0.945757 0.970423 0.913897 0.728298 0.810609
Joon Sang Lee Sanofi JSLee_NA12878MOD_final_4.vcf.gz 0 0 0 0 0 5 5 0.998844 0.921197 0.95845 1 0.000106 0.000213

The second table provides detailed variant detection information for each of the 50 injected variants from all qualified submissions. This table also specifies all injected variants with their expected VAF. In this table, VAF is displayed if the variant is present in submitted VCF for a specific entry and the VAF information was derived from the VCF file (i.e. VAF, AD/DP, or AB meta tag was available in the VCF file). For variants which were present in the VCF file, but failed to pass the filtering criteria (as defined by the filter meta tag), the variant is annotated as “filtered” with its associated VAF. Participant entries that supplied VAF data in accordance with the challenge instructions, and that detected all 50 variants reasonably close to the expected VAF values, are being recognized as Warm Up in silico VAF Spotters, indicated by the VAF Spotter icon in the table below (37 entries earned this title). These recognitions are based on the information found in raw VCF data for each entry, regardless of whether the submitter called each of the variants as above 20%. This is due to various reasons, including quality filters set for the pipeline.


Entry Variant 1

chr: 1
pos: 27093043
G T
true vaf: 0.45
target vaf: 0.50
Variant 2

chr: 1
pos: 27106406
GGCT G
true vaf: 0.20
target vaf: 0.20
Variant 3

chr: 1
pos: 51439612
AGGTGC A
true vaf: 0.47
target vaf: 0.50
Variant 4

chr: 1
pos: 161143427
G A
true vaf: 0.43
target vaf: 0.50
Variant 5

chr: 1
pos: 161143694
CG C
true vaf: 0.24
target vaf: 0.20
Variant 6

chr: 1
pos: 201984364
ACGGGTGGATGGC A
true vaf: 0.42
target vaf: 0.50
Variant 7

chr: 2
pos: 148657316
CT C
true vaf: 0.22
target vaf: 0.20
Variant 8

chr: 2
pos: 148676143
AACCTGCCAT A
true vaf: 0.44
target vaf: 0.50
Variant 9

chr: 2
pos: 198266831
CTTTCTG C
true vaf: 0.18
target vaf: 0.20
Variant 10

chr: 3
pos: 41266085
CAGTCTTACCTGG C
true vaf: 0.17
target vaf: 0.20
Variant 11

chr: 3
pos: 52442586
GATCC G
true vaf: 0.42
target vaf: 0.50
Variant 12

chr: 3
pos: 52597407
AATATCATCAT A
true vaf: 0.15
target vaf: 0.20
Variant 13

chr: 3
pos: 121208445
TTTA T
true vaf: 0.48
target vaf: 0.50
Variant 14

chr: 3
pos: 186502465
CTAT C
true vaf: 0.50
target vaf: 0.50
Variant 15

chr: 4
pos: 55152090
GAGACATCAT G
true vaf: 0.18
target vaf: 0.20
Variant 16

chr: 4
pos: 106156565
A AT
true vaf: 0.14
target vaf: 0.20
Variant 17

chr: 4
pos: 153244142
A AAACTCCCC
true vaf: 0.13
target vaf: 0.20
Variant 18

chr: 5
pos: 67591073
TATCGAGAAA T
true vaf: 0.17
target vaf: 0.20
Variant 19

chr: 5
pos: 112175182
T TCTGCTAATACC
true vaf: 0.18
target vaf: 0.20
Variant 20

chr: 6
pos: 26158586
G GATTC
true vaf: 0.21
target vaf: 0.20
Variant 21

chr: 7
pos: 106523590
AT A
true vaf: 0.54
target vaf: 0.50
Variant 22

chr: 8
pos: 117874090
GCAGTGGCTGAT G
true vaf: 0.44
target vaf: 0.50
Variant 23

chr: 9
pos: 120475316
TTTAA T
true vaf: 0.21
target vaf: 0.20
Variant 24

chr: 9
pos: 139397775
C CGGAAAGCGG
true vaf: 0.33
target vaf: 0.50
Variant 25

chr: 10
pos: 8111542
T TTACTGAA
true vaf: 0.16
target vaf: 0.20
Variant 26

chr: 10
pos: 63816961
TTGCCATTGG T
true vaf: 0.36
target vaf: 0.50
Variant 27

chr: 10
pos: 63850750
TCCAGAGTAGAC T
true vaf: 0.40
target vaf: 0.50
Variant 28

chr: 10
pos: 89624241
CAA C
true vaf: 0.41
target vaf: 0.50
Variant 29

chr: 10
pos: 123276898
TATTCCCC T
true vaf: 0.16
target vaf: 0.20
Variant 30

chr: 11
pos: 32413529
G GT
true vaf: 0.26
target vaf: 0.20
Variant 31

chr: 11
pos: 69466026
CGACGTGCGG C
true vaf: 0.12
target vaf: 0.20
Variant 32

chr: 12
pos: 115115435
G GT
true vaf: 0.17
target vaf: 0.20
Variant 33

chr: 13
pos: 28608148
G GTACGTGCATTTGGAAAAGTGATGAACGCAACAGCTTA
true vaf: 0.53
target vaf: 0.50
Variant 34

chr: 13
pos: 28623570
AGTGTAGTATCCG A
true vaf: 0.21
target vaf: 0.20
Variant 35

chr: 13
pos: 32912707
TAAAG T
true vaf: 0.21
target vaf: 0.20
Variant 36

chr: 13
pos: 48936946
TACAGAA T
true vaf: 0.43
target vaf: 0.50
Variant 37

chr: 16
pos: 67070639
TAGAA T
true vaf: 0.12
target vaf: 0.20
Variant 38

chr: 16
pos: 67644795
GGAGA G
true vaf: 0.50
target vaf: 0.50
Variant 39

chr: 16
pos: 68835746
AAAGTCACGCTG A
true vaf: 0.19
target vaf: 0.20
Variant 40

chr: 16
pos: 68846132
C CCACCAA
true vaf: 0.21
target vaf: 0.20
Variant 41

chr: 16
pos: 68856070
CACAGCAGA C
true vaf: 0.51
target vaf: 0.50
Variant 42

chr: 16
pos: 68867224
C T
true vaf: 0.46
target vaf: 0.50
Variant 43

chr: 17
pos: 29541466
TAGAGTCTTAC T
true vaf: 0.15
target vaf: 0.20
Variant 44

chr: 17
pos: 37676280
AACAGACCCT A
true vaf: 0.42
target vaf: 0.50
Variant 45

chr: 17
pos: 41245089
TTGGAACAACCA T
true vaf: 0.47
target vaf: 0.50
Variant 46

chr: 17
pos: 56056604
TTGC T
true vaf: 0.55
target vaf: 0.50
Variant 47

chr: 19
pos: 47503717
C A
true vaf: 0.52
target vaf: 0.50
Variant 48

chr: 20
pos: 30954203
C T
true vaf: 0.41
target vaf: 0.50
Variant 49

chr: 21
pos: 44514767
C CACTCAT
true vaf: 0.46
target vaf: 0.50
Variant 50

chr: 22
pos: 41574281
TGCAACAGCAGCA T
true vaf: 0.57
target vaf: 0.50
SKESA_SRPRISM Not Found Not Found 1 1 0.98 0.98 1 1 Not Found Not Found 1 Not Found 1 1 Not Found Not Found Not Found Not Found 1 Not Found 0.95 Not Found 1 1 Not Found 1 Not Found 0.98 Not Found 1 Not Found Not Found Not Found 1 1 1 Not Found 1 1 1 1 Not Found Not Found 1 1 0.98 Not Found Not Found 0.98 1
B15GATK36 VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.37 0.23 0.41 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.44 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.58
B8GATK36 VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.37 0.23 0.41 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.44 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.58
Saphetor4 VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.37 0.23 0.39 0.21 0.18 0.43 0.13 0.51 0.5 0.14 0.15 0.14 0.17 0.21 0.22 0.54 0.36 0.25 0.37 0.2 0.34 0.44 0.41 0.17 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.48 0.52 0.14 0.39 0.44 0.44 0.51 0.43 0.47 0.52
BIG_CelerSNP-NA12878.vcf Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available
BIG_HXG-NA12878.vcf.gz Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Found Not Available Not Available Not Available Not Available Not Found Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Found Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available
BIG_myPipeline-NA12878.vcf.gz Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available
BIG_NGSToolkit-NA12878.vcf Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available Not Available
DeepVariant_LowFrequency 0.48 0.25 0.49 0.44 0.29 (Filtered) 0.45 0.23 0.4 0.2 0.2 0.44 0.16 0.53 0.52 0.2 0.15 0.13 (Filtered) 0.18 0.18 0.21 0.53 0.4 0.27 0.35 0.15 (Filtered) 0.36 0.49 0.42 0.21 0.27 0.21 0.19 (Filtered) 0.38 0.25 0.24 0.48 0.16 (Filtered) 0.49 0.23 0.23 0.54 0.5 0.17 0.46 0.5 0.59 0.51 0.43 0.47 0.57
DeepVariant 0.48 0.25 (Filtered) 0.49 0.44 0.29 (Filtered) 0.45 0.23 0.4 0.2 0.2 0.44 0.16 (Filtered) 0.53 0.52 0.2 0.15 0.13 (Filtered) 0.18 0.18 0.21 0.53 0.4 0.27 0.35 0.15 (Filtered) 0.36 0.49 0.42 0.21 0.27 0.21 0.19 (Filtered) 0.38 0.25 0.24 0.48 0.16 (Filtered) 0.49 0.23 0.23 0.54 0.5 0.17 (Filtered) 0.46 0.5 0.59 0.51 0.43 0.47 0.57
DRAGEN_DNASeq_NA12878MOD_submission1 VAF Spotter 0.47 0.23 0.45 0.47 0.26 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
DRAGEN_DNASeq_NA12878MOD_submission2 VAF Spotter 0.47 0.23 0.45 0.47 0.26 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
DRAGEN_DNASeq_NA12878MOD_submission3 0.47 0.23 0.45 0.47 0.26 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 Not Found 0.51 0.43 0.47 0.54
DRAGEN_DNASeq_NA12878MOD_submission4 0.47 0.23 0.45 0.47 0.26 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 Not Found 0.51 0.43 0.47 0.54
DRAGEN_DNASeq_NA12878MOD_submission5 VAF Spotter 0.47 0.23 0.45 0.47 0.26 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
DRAGEN_DNASeq_NA12878MOD_submission6 VAF Spotter 0.47 0.23 0.45 0.47 0.26 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
DRAGEN_DNASeq_NA12878MOD_submission7b VAF Spotter 0.47 0.23 0.45 0.47 0.26 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
Saphetor1 VAF Spotter 0.47 0.23 0.46 0.47 0.27 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.2 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
Saphetor2 VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
Saphetor3 VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
MySubmission2 0.47 0.24 0.45 0.47 0.26 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.53 0.39 0.25 0.37 0.2 0.34 0.45 0.44 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 Not Found 0.41 0.45 0.44 0.51 0.43 0.47 0.54
Experimental Unfiltered 0.48 0.22 0.45 0.46 0.26 0.37 0.22 0.4 0.2 0.18 0.43 0.13 0.51 0.51 0.14 0.15 0.13 0.17 0.19 0.21 0.54 0.36 0.25 0.37 0.18 0.33 0.43 0.42 0.18 0.28 Not Found 0.18 0.55 0.21 0.23 0.45 0.13 0.45 0.19 0.24 0.49 0.52 0.14 0.4 0.44 0.44 0.5 0.44 0.47 0.53
NCH_SUBMISSION2 0.47 0.23 0.45 0.49 0.27 0.36 0.21 0.39 0.21 Not Found 0.41 Not Found 0.52 0.5 Not Found Not Found Not Found Not Found Not Found 0.21 0.54 0.41 0.24 0.39 0.2 0.37 0.46 0.42 Not Found 0.23 Not Found Not Found 0.55 0.22 0.24 0.44 Not Found 0.46 Not Found 0.23 0.5 0.49 Not Found 0.42 0.46 0.57 0.54 0.4 0.46 0.55
NCH_SUBMISSION1 VAF Spotter 0.47 0.23 0.45 0.49 0.27 0.36 0.21 0.39 0.21 0.16 0.41 0.14 0.52 0.5 0.16 0.15 0.14 0.17 0.19 0.21 0.54 0.41 0.24 0.39 0.2 0.37 0.46 0.42 0.18 0.23 0.13 0.2 0.55 0.22 0.24 0.44 0.14 0.46 0.2 0.23 0.5 0.49 0.14 0.42 0.46 0.57 0.54 0.4 0.46 0.55
JLack_CCBR_Leidos_StandardPipeline_noFilter 0.48 0.22 0.44 0.46 0.27 0.36 0.24 0.4 0.21 0.17 0.44 0.14 0.5 0.52 0.14 0.14 0.13 0.18 0.21 0.22 0.54 0.38 0.24 0.37 0.16 0.33 0.44 0.43 0.16 0.3 0.14 0.18 0.56 0.22 0.22 0.45 0.13 0.46 0.2 0.24 0.53 0.54 0.14 0.41 0.44 0.39 0.5 0.43 0.47 0.59
JLack_CCBR_Leidos_StandardPipeline_relaxed 0.48 0.22 0.44 0.46 0.27 0.36 0.24 0.4 0.21 0.17 0.44 0.14 0.5 0.52 0.14 0.14 0.13 0.18 0.21 0.22 0.54 0.38 0.24 0.37 0.16 0.33 0.44 0.43 0.16 0.3 0.14 0.18 0.56 0.22 0.22 0.45 0.13 0.46 0.2 0.24 0.53 0.54 0.14 0.41 0.44 0.39 0.5 0.43 0.47 0.59
JSLee_NA12878MOD_final_2.vcf.gz VAF Spotter 0.48 0.22 0.46 0.44 0.27 0.37 0.23 0.42 0.21 0.17 0.44 0.15 0.51 0.5 0.16 0.15 0.14 0.16 0.21 0.22 0.54 0.39 0.25 0.38 0.19 0.34 0.44 0.42 0.18 0.28 0.15 0.18 0.57 0.21 0.23 0.45 0.13 0.46 0.2 0.24 0.5 0.49 0.14 0.4 0.46 0.42 0.5 0.42 0.48 0.55
JSLee_NA12878MOD_final_3.vcf.gz VAF Spotter 0.48 0.22 0.46 0.44 0.27 0.37 0.23 0.42 0.21 0.17 0.44 Not Found 0.51 0.5 0.16 Not Found Not Found 0.16 0.21 0.22 0.54 0.39 0.25 0.38 Not Found 0.34 0.44 0.42 0.18 0.28 Not Found 0.18 0.57 0.21 0.23 0.45 Not Found 0.46 0.2 0.24 0.5 0.49 Not Found 0.4 0.46 0.42 0.5 0.42 0.48 0.55
JSLee_NA12878MOD_final_4.vcf.gz VAF Spotter 0.48 Not Found Not Found 0.44 Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found 0.49 Not Found Not Found Not Found Not Found 0.5 0.42 Not Found Not Found
KCCG_1.7.0_HC VAF Spotter 0.48 0.23 0.45 0.47 0.27 0.37 0.23 0.41 0.21 0.17 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.38 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.56 0.21 0.23 0.44 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.42 0.47 0.58
KCCG_1.7.0_VD 0.48 0.23 0.48 0.44 0.24 0.42 0.23 0.4 0.22 0.17 0.43 0.17 0.52 0.47 0.19 0.15 Not Found 0.18 0.21 0.21 0.53 0.41 0.25 0.38 0.19 0.36 0.44 0.42 0.18 0.27 Not Found 0.19 0.55 0.23 0.23 0.44 Not Found 0.45 0.21 0.23 0.5 0.49 0.15 0.42 0.49 0.3 0.51 0.42 0.47 0.56
Bowtie2 + GATK HaplotypeCaller depth-filtered 0.47 0.24 0.45 0.46 0.27 0.37 0.23 0.41 0.21 0.18 0.43 0.15 0.51 0.5 0.15 0.15 0.14 0.18 0.2 0.19 0.54 0.39 0.25 0.36 0.2 0.34 0.45 0.34 0.18 0.28 0.15 0.19 0.42 0.22 0.23 0.45 0.13 0.46 0.2 0.24 0.5 0.52 Not Found 0.41 0.45 0.44 0.51 0.43 0.46 0.54
Bowtie2 + GATK HaplotypeCaller unfiltered 0.47 0.24 0.45 0.46 0.27 0.37 0.23 0.41 0.21 0.18 0.43 0.15 0.51 0.5 0.15 0.15 0.14 0.18 0.2 0.19 0.54 0.39 0.25 0.36 0.2 0.34 0.45 0.34 0.18 0.28 0.15 0.19 0.42 0.22 0.23 0.45 0.13 0.46 0.2 0.24 0.5 0.52 Not Found 0.41 0.45 0.44 0.51 0.43 0.46 0.54
Challenge_submission_20170912_3 0.47 0.23 0.45 0.47 0.26 0.37 0.23 0.41 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 Not Found 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
GATK HaplotypeCaller depth-filtered VAF Spotter 0.47 0.23 0.46 0.46 0.27 0.37 0.23 0.41 0.21 0.18 0.43 0.14 0.51 0.51 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.19 0.34 0.45 0.41 0.17 0.28 0.15 0.19 0.56 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.5 0.14 0.41 0.45 0.42 0.51 0.44 0.46 0.54
GATK HaplotypeCaller unfiltered VAF Spotter 0.47 0.23 0.46 0.46 0.27 0.37 0.23 0.41 0.21 0.18 0.43 0.14 0.51 0.51 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.19 0.34 0.45 0.41 0.17 0.28 0.15 0.19 0.56 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.5 0.14 0.41 0.45 0.42 0.51 0.44 0.46 0.54
Test VAF Spotter 0.47 0.24 0.45 0.46 0.25 0.37 0.23 0.43 0.2 0.18 0.42 0.14 0.51 0.5 0.15 0.14 0.15 0.18 0.21 0.22 0.55 0.4 0.25 0.35 0.19 0.35 0.42 0.42 0.18 0.27 0.14 0.19 0.56 0.23 0.23 0.45 0.12 0.47 0.19 0.23 0.5 0.51 0.15 0.41 0.45 0.44 0.52 0.42 0.48 0.54
NA12878MOD.imp.hardfilter.recode.vcf.gz VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
NA12878MOD.imp.v2.recode.vcf.gz VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
NA12878MOD.imp.v3.recode.vcf VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
NA12878MOD.imp.vcf.gz VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
Whole-exome variant calling pipeline results 0.44 Not Found 0.44 0.44 0.22 0.36 Not Found 0.45 Not Found Not Found 0.38 Not Found 0.47 0.47 Not Found Not Found Not Found Not Found Not Found Not Found 0.54 0.42 Not Found 0.33 Not Found 0.35 0.36 0.4 Not Found 0.25 Not Found Not Found Not Found Not Found 0.22 0.42 Not Found 0.47 Not Found Not Found 0.5 0.46 Not Found 0.38 0.44 0.33 0.52 0.41 0.46 0.53
ADIscan_NA12878MOD_all 0.44 0.18 0.4 0.46 0.22 0.42 0.21 0.45 0.16 Not Found 0.4 0.12 0.46 0.44 0.15 0.14 0.13 0.17 0.16 0.19 0.54 0.42 0.22 0.3 0.14 0.35 0.39 0.41 0.13 0.25 0.12 0.17 Not Found 0.21 0.21 0.4 0.1 0.48 0.19 0.2 0.47 0.48 0.12 0.37 0.45 0.29 0.51 0.4 0.44 0.55
ADIscan_NA12878MOD_conf 0.44 0.18 0.4 0.46 0.22 0.42 0.21 0.45 0.16 Not Found 0.4 0.12 0.46 0.44 0.15 0.14 0.13 0.17 0.16 0.19 0.54 0.42 0.22 0.3 0.14 0.35 0.39 0.41 0.13 0.25 0.12 0.17 Not Found 0.21 0.21 0.4 0.1 0.48 0.19 0.2 0.47 0.48 0.12 0.37 0.45 0.29 0.51 0.4 0.44 0.55
ADIscan_NA12878MOD_filtered 0.44 0.18 0.4 0.46 0.22 0.42 0.21 0.45 0.16 Not Found 0.4 0.12 0.46 0.44 0.15 0.14 0.13 0.17 0.16 0.19 0.54 0.42 0.22 0.3 0.14 0.35 0.39 0.41 0.13 0.25 0.12 0.17 Not Found 0.21 0.21 0.4 0.1 0.48 0.19 0.2 0.47 0.48 0.12 0.37 0.45 0.29 0.51 0.4 0.44 0.55
ADIscan_NA12878MOD_tight 0.44 0.18 0.4 0.46 0.22 0.42 0.21 0.45 0.16 Not Found 0.4 0.12 0.46 0.44 0.15 0.14 0.13 0.17 0.16 0.19 0.54 0.42 0.22 0.3 0.14 0.35 0.39 0.41 0.13 0.25 0.12 0.17 Not Found 0.21 0.21 0.4 0.1 0.48 0.19 0.2 0.47 0.48 0.12 0.37 0.45 0.29 0.51 0.4 0.44 0.55
HULP-germ 0.46 0.22 0.24 0.47 0.24 0.2 0.23 0.21 0.18 0.16 0.2 0.14 0.26 0.23 0.16 0.14 0.14 0.16 0.19 0.2 0.27 0.21 0.23 0.17 0.18 0.17 0.2 0.14 0.16 0.28 0.12 0.18 Not Found 0.19 0.22 0.22 0.11 0.23 0.17 0.22 0.25 0.5 Not Found 0.18 0.24 0.25 0.52 0.44 0.23 0.28
Submission1 0.47 0.24 0.45 0.47 0.26 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.53 0.39 0.25 0.37 0.2 0.34 0.45 0.44 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 Not Found 0.41 0.45 0.44 0.51 0.43 0.47 0.53
SeqsLab with GATK-based Parallelization 0.47 0.24 0.45 0.47 0.26 0.37 0.23 0.41 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 Not Found 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
SeqsLab with GATK-based Parallelization(conf>30) 0.47 0.24 0.45 0.47 0.26 0.37 0.23 0.41 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 Not Found 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
NCBI_Magic_ThierryMieg_NA12878MOD.b.vcf.gz 0.49 Not Found 0.47 0.44 (Filtered) 0.24 (Filtered) 0.47 0.22 (Filtered) Not Found Not Found 0.2 Not Found Not Found 0.45 0.44 Not Found Not Found Not Found Not Found Not Found Not Found 0.57 Not Found 0.22 Not Found Not Found 0.38 Not Found 0.42 Not Found 0.25 Not Found Not Found Not Found 0.21 0.26 0.45 Not Found Not Found 0.21 Not Found 0.54 0.5 Not Found Not Found Not Found 0.26 0.54 0.45 Not Found 0.59
BWA-MEM + GATK + SNVer 0.47 0.17 0.29 0.43 0.2 0.29 0.19 0.29 0.16 Not Found 0.3 Not Found 0.34 0.32 Not Found 0.13 Not Found Not Found 0.17 Not Found 0.35 0.27 0.19 0.22 Not Found 0.24 0.28 0.29 Not Found 0.21 Not Found 0.17 Not Found 0.18 0.19 0.3 Not Found 0.32 0.17 0.18 0.32 0.53 Not Found 0.27 0.3 0.24 0.48 0.43 0.32 0.33
NovoalignFreebayes_1 0.47 0.24 0.44 0.44 0.24 0.45 0.23 0.41 0.21 0.2 0.42 Not Found 0.52 0.49 0.2 0.14 Not Found 0.17 0.17 0.21 0.51 0.39 0.24 0.33 0.15 0.34 0.46 0.39 0.18 0.25 0.16 0.19 0.4 0.24 0.22 0.43 Not Found 0.46 0.24 0.22 0.52 0.49 0.15 0.4 0.47 0.38 0.5 0.39 0.47 0.58
NovoalignFreebayes_2 0.45 0.16 0.41 0.41 0.21 0.39 0.2 0.36 0.17 0.18 0.38 Not Found 0.48 0.45 0.19 0.13 Not Found 0.14 Not Found 0.18 0.48 0.34 0.21 0.3 0.14 0.29 0.45 0.35 Not Found 0.23 Not Found 0.13 0.22 0.16 0.18 0.38 Not Found 0.42 0.2 0.21 0.46 0.47 Not Found 0.32 0.42 0.41 0.49 0.37 0.43 0.54
NovoalignGATKHC_1 VAF Spotter 0.47 0.24 0.45 0.47 0.27 0.36 0.23 0.4 0.21 0.17 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.22 0.21 0.54 0.39 0.25 0.39 0.19 0.34 0.44 0.42 0.18 0.28 0.15 0.19 0.57 0.21 0.23 0.46 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.4 0.45 0.42 0.51 0.42 0.47 0.54
NovoalignGATKHC_2 VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.36 0.23 0.4 0.21 0.17 0.42 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.22 0.21 0.54 0.39 0.25 0.38 0.19 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.56 0.21 0.23 0.45 0.13 0.45 0.19 0.24 0.5 0.52 0.14 0.39 0.45 0.42 0.51 0.42 0.47 0.54
Sentieon_DNAseq_allmap_nodedup-NA12878MOD 0.45 0.21 0.42 0.46 0.24 0.36 0.21 0.45 0.17 0.16 0.41 0.11 0.48 0.49 0.14 0.14 0.14 0.17 0.18 0.2 0.54 0.42 0.22 0.33 0.17 0.34 0.39 0.42 0.16 0.26 0.12 0.17 0.53 0.2 0.22 0.43 0.11 0.48 0.17 0.21 0.47 0.48 0.14 0.39 0.43 0.41 0.52 0.41 0.45 0.54
Sentieon_DNAseq_allmap-NA12878MOD VAF Spotter 0.47 0.23 0.45 0.47 0.26 0.37 0.23 0.41 0.2 0.18 0.44 0.12 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.36 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.53 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.49 0.53 0.14 0.4 0.44 0.44 0.51 0.43 0.47 0.54
Sentieon_DNAseq_nodecoy-NA12878MOD VAF Spotter 0.47 0.23 0.45 0.47 0.26 0.37 0.23 0.41 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
Sentieon_DNAseq_std-NA12878MOD VAF Spotter 0.47 0.23 0.45 0.47 0.26 0.37 0.23 0.41 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 0.14 0.41 0.45 0.44 0.51 0.43 0.47 0.54
Sentieon_Exp_nodedup-NA12878MOD 0.45 0.21 0.44 0.46 0.25 0.36 0.22 0.46 0.18 0.17 0.43 0.13 0.48 0.49 0.16 0.14 0.14 0.17 0.19 0.21 0.6 0.42 0.23 0.36 0.16 0.36 0.39 0.44 0.17 0.26 0.12 0.17 0.54 0.21 0.22 0.44 0.12 0.48 0.17 0.22 0.51 0.48 0.14 0.41 0.44 0.41 0.55 0.44 0.47 0.55
Sentieon_Exp-NA12878MOD VAF Spotter 0.48 0.24 0.45 0.48 0.27 0.37 0.23 0.42 0.22 0.18 0.47 0.14 0.51 0.52 0.16 0.15 0.15 0.18 0.21 0.21 0.57 0.39 0.26 0.39 0.18 0.35 0.45 0.45 0.2 0.28 0.15 0.19 0.52 0.22 0.23 0.47 0.13 0.46 0.2 0.24 0.52 0.53 0.14 0.42 0.45 0.44 0.55 0.46 0.49 0.55
Sentieon_TNscope_Tonly_allmap_nodedup-NA12878MOD 0.45 0.21 0.44 0.46 0.25 0.36 0.22 0.46 0.18 0.17 0.43 0.13 0.48 0.49 0.16 0.14 0.14 0.17 0.19 0.21 0.6 0.42 0.23 0.36 0.16 0.36 0.39 0.44 0.17 0.26 0.12 0.17 0.54 0.21 0.22 0.44 0.12 0.48 0.17 0.22 0.51 0.48 0.14 0.41 0.44 0.41 0.55 0.44 0.47 0.55
Sentieon_TNscope_Tonly_allmap-NA12878MOD VAF Spotter 0.48 0.24 0.45 0.48 0.27 0.37 0.23 0.42 0.22 0.18 0.47 0.14 0.51 0.52 0.16 0.15 0.15 0.18 0.21 0.21 0.57 0.39 0.26 0.39 0.18 0.35 0.45 0.45 0.2 0.28 0.15 0.19 0.52 0.22 0.23 0.47 0.13 0.46 0.2 0.24 0.52 0.53 0.14 0.42 0.45 0.44 0.55 0.46 0.49 0.55
Sentieon_TNscope_Tonly_nodecoy-NA12878MOD VAF Spotter 0.48 0.24 0.45 0.48 0.28 0.37 0.23 0.42 0.22 0.18 0.46 0.15 0.52 0.52 0.16 0.15 0.15 0.18 0.21 0.21 0.57 0.4 0.26 0.38 0.18 0.35 0.44 0.45 0.2 0.28 0.15 0.19 0.54 0.22 0.23 0.47 0.13 0.47 0.2 0.24 0.53 0.53 0.15 0.42 0.46 0.44 0.55 0.46 0.49 0.55
Sentieon_TNscope_Tonly_std-NA12878MOD VAF Spotter 0.48 0.24 0.45 0.48 0.28 0.37 0.23 0.42 0.22 0.18 0.46 0.15 0.52 0.52 0.16 0.15 0.15 0.18 0.21 0.21 0.57 0.4 0.26 0.38 0.18 0.35 0.44 0.45 0.2 0.28 0.15 0.19 0.54 0.22 0.23 0.47 0.13 0.47 0.2 0.24 0.53 0.53 0.15 0.42 0.46 0.44 0.55 0.46 0.49 0.55
SGI_1st_result VAF Spotter 0.47 (Filtered) 0.23 0.46 (Filtered) 0.47 0.26 (Filtered) 0.37 0.23 (Filtered) 0.41 0.21 (Filtered) 0.18 (Filtered) 0.43 0.14 (Filtered) 0.51 (Filtered) 0.5 0.15 (Filtered) 0.15 (Filtered) 0.14 (Filtered) 0.18 0.21 (Filtered) 0.21 0.54 0.39 0.25 (Filtered) 0.37 0.2 (Filtered) 0.34 (Filtered) 0.44 0.42 0.18 (Filtered) 0.28 (Filtered) 0.15 0.19 (Filtered) 0.58 (Filtered) 0.21 (Filtered) 0.23 (Filtered) 0.45 0.13 (Filtered) 0.46 0.19 (Filtered) 0.24 0.5 0.52 0.14 (Filtered) 0.41 0.45 (Filtered) 0.44 (Filtered) 0.51 0.43 0.47 0.54
SGI_2nd_filtration VAF Spotter 0.47 0.23 0.46 0.47 0.26 (Filtered) 0.37 0.23 (Filtered) 0.41 0.21 0.18 (Filtered) 0.43 0.14 (Filtered) 0.51 (Filtered) 0.5 0.15 (Filtered) 0.15 (Filtered) 0.14 (Filtered) 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 (Filtered) 0.34 0.44 0.42 0.17 (Filtered) 0.28 0.15 0.2 (Filtered) 0.58 (Filtered) 0.21 0.23 (Filtered) 0.45 0.13 (Filtered) 0.46 0.19 (Filtered) 0.24 0.5 0.52 0.14 (Filtered) 0.41 0.45 0.44 (Filtered) 0.51 0.43 0.47 0.54
SGI_4th_filtration VAF Spotter 0.47 0.23 (Filtered) 0.46 0.47 0.26 0.37 0.23 0.41 0.2 0.18 0.43 0.14 0.51 (Filtered) 0.52 (Filtered) 0.15 (Filtered) 0.15 0.14 0.18 0.21 0.21 0.53 0.38 0.24 0.38 (Filtered) 0.18 0.34 0.43 0.42 0.17 0.26 0.15 (Filtered) 0.17 0.58 0.2 (Filtered) 0.23 0.45 0.11 0.46 0.2 0.24 0.49 0.53 0.14 0.41 0.45 0.43 (Filtered) 0.49 0.43 0.47 0.59
SGI_3rd_filtration_rere 0.47 0.23 (Filtered) Not Available 0.47 Not Available Not Available Not Available Not Available 0.21 0.18 (Filtered) Not Available 0.14 (Filtered) Not Available Not Available 0.15 (Filtered) 0.15 (Filtered) 0.14 (Filtered) 0.18 0.21 0.21 Not Available Not Available Not Available Not Available 0.2 (Filtered) Not Available 0.44 Not Available 0.17 (Filtered) Not Available 0.15 (Filtered) 0.2 (Filtered) 0.58 (Filtered) Not Available Not Available Not Available 0.13 (Filtered) Not Available Not Available Not Available Not Available 0.52 0.14 (Filtered) Not Available Not Available 0.44 (Filtered) 0.51 0.43 Not Available 0.54
SIB 0.45 0.2 0.42 0.44 0.22 0.41 0.23 0.39 0.19 0.18 0.42 Not Found 0.47 0.45 0.18 Not Found Not Found 0.82 Not Found 0.2 0.48 0.4 0.2 0.29 Not Found 0.34 0.4 0.36 0.17 0.26 Not Found Not Found 0.69 0.22 0.24 0.39 Not Found 0.45 0.2 0.21 0.48 0.49 0.2 0.33 0.45 0.23 0.53 0.44 0.44 0.51
MySubmission1 0.47 0.24 0.45 0.47 0.26 0.37 0.23 0.4 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.53 0.39 0.25 0.37 0.2 0.34 0.45 0.44 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.45 0.13 0.46 0.19 0.24 0.5 0.52 Not Available 0.41 0.45 0.44 0.51 0.43 0.47 0.53
mySubmission_GATK 0.47 0.23 (Filtered) 0.45 0.47 0.26 0.37 0.23 0.41 0.2 0.18 0.44 0.14 0.51 (Filtered) 0.52 (Filtered) 0.15 0.15 0.14 0.18 0.21 0.21 0.53 0.38 0.24 0.38 0.18 0.34 0.45 0.43 0.18 0.26 0.15 (Filtered) 0.16 0.58 0.2 0.23 0.45 0.12 0.47 0.2 0.24 0.49 0.51 0.07 0.41 0.45 Not Found 0.49 0.43 0.47 0.28
Yotta1_GRCh37_liftover_from_GRCh38_sorted VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.37 0.23 0.41 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 (Filtered) 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.44 0.13 0.46 0.19 0.24 0.5 0.52 0.14 (Filtered) 0.41 0.45 0.44 0.51 0.43 0.57 0.58
Yotta2_GRCh37_liftover_from_GRCh38_sorted 0.45 Not Found Not Found 0.44 Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found Not Found 0.46 Not Found Not Found Not Found Not Found 0.52 0.42 Not Found Not Found
Yotta3_GRCh37_liftover_from_GRCh38_sorted VAF Spotter 0.47 0.23 0.45 0.47 0.27 0.37 0.23 0.41 0.21 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.21 0.21 0.54 0.39 0.25 0.37 0.2 0.34 0.45 0.42 (Filtered) 0.18 0.28 0.15 0.19 0.55 0.21 0.23 0.44 0.13 0.46 0.19 0.24 0.5 0.52 0.14 (Filtered) 0.41 0.45 0.44 0.51 0.43 0.57 0.58
G3GATK36 0.47 0.23 0.45 0.46 0.27 0.36 0.23 0.4 0.2 0.18 0.43 0.14 0.51 0.5 0.15 0.15 0.14 0.18 0.22 0.21 0.53 0.39 0.25 0.37 0.2 0.34 0.44 0.42 0.18 0.28 0.15 0.2 0.29 0.21 0.23 0.44 0.13 0.46 0.19 0.24 0.5 0.51 0.13 0.41 0.45 0.44 0.51 0.44 0.47 0.58
HULP-mosaic 0.44 0.18 0.38 0.44 (Filtered) Not Found 0.35 0.22 0.39 0.16 0.18 (Filtered) 0.35 Not Found 0.5 0.43 0.17 0.14 Not Found 0.13 (Filtered) Not Found 0.17 (Filtered) 0.55 0.37 0.19 0.26 0.12 0.29 0.31 0.38 0.14 0.24 0.1 (Filtered) 0.16 Not Found 0.18 0.21 0.36 0.11 (Filtered) 0.44 0.15 0.2 0.42 (Filtered) 0.48 Not Found 0.3 (Filtered) 0.38 0.35 0.49 0.4 (Filtered) 0.45 0.47